Meta-Transcriptomic Analysis Uncovers the Presence of Four Novel Viruses and Multiple Known Virus Genera in a Single Hibiscus rosa-sinensis Plant in Colombia.

Hibiscus is not native to Colombia but well suited to its arid soil and dry climates. A single hibiscus plant from Risaralda, showing black spots on upper and lower sides of its leaves, was collected for virome analysis using meta-transcriptomic high-throughput sequencing technology. Bioinformatic analysis identified 12.5% of the total reads in the Ribo-Zero cDNA library which mapped to viral genomes. BLAST searches revealed the presence of carlavirus, potexvirus, and of known members of the genera Betacarmovirus, Cilevirus, Nepovirus, and Tobamovirus in the sample; confirmed by RT-PCR with virus-specific primers followed by amplicon sequencing. Furthermore, in silico analysis suggested the possibility of a novel soymovirus, and a new hibiscus strain of citrus leprosis virus C2 in the mixed infection. Both RNA dependent RNA polymerase and coat protein gene sequences of the potex and carla viruses shared less than 72% nucleotide and 80% amino acid identities with any alphaflexi- and betaflexi-virus sequences available in GenBank, identifying three novel carlavirus and one potexvirus species in the Hibiscus rosa-sinensis plant. The detection of physalis vein necrosis nepovirus and passion fruit green spot cilevirus in hibiscus are also new reports from Colombia. Overall, the meta-transcriptome analysis identified the complex virome associated with the black spot symptoms on hibiscus leaves and demonstrated the diversity of virus genera tolerated in the mixed infection of a single H. rosa-sinensis plant.

First report of Passion fruit green spot virus in yellow Passion fruit (Passiflora edulis f. flavicarpa) in Casanare, Colombia.

Passiflora edulis, commonly known as passion fruit, is a vine species of passionflower native to South America. In Colombia, yellow passion fruit (P. edulis f. flavicarpa) is the most important species in terms of net production and local consumption. Recently two brevipalpus transmitted cileviruses, (i) passion fruit green spot virus (PfGSV) and (ii) hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) were detected in passion fruit in Brazil and Hawaii, respectively (Ramos-González et al., 2020, Olmedo-Velarde et al., 2022). CiLV-C2H infects both citrus and hibiscus in Colombia (Roy et al., 2015, 2018) but there was no report of PfGSV elsewhere apart from Brazil and Paraguay (Costa-Rodrigues et al., 2022). Apart from emerging begomovirus diseases, five major viruses are known to infect passion fruit in Colombia: soybean mosaic virus (SMV), cowpea aphid-borne mosaic virus, passion fruit yellow mosaic virus, cucumber mosaic virus, and a tentative Gulupa bacilliform badnavirus A (Cardona et al., 2022). Current findings of CiLV-C2H in passion fruit and PfGSV in hibiscus motivated us to investigate the possibilities of cilevirus infection in passion fruit in Colombia. During surveys, along with healthy yellow passion fruit leaves, five symptomatic plant samples from Meta and three from Casanare were collected before sent to the Molecular Plant Pathology Laboratory at Beltsville, MD under APHIS permit. Passion fruit samples from Meta showed leaf mottling, rugose mosaic, and leaf distortion, whereas leaf variegation, chlorotic spots, yellowing, green spots in senescent leaves and green vein banding were observed in the Casanare samples (Supp. Fig. 1). Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, USA). To know the potential cilevirus infection in these samples, three PfGSV specific (Ramos-González et al. 2020) and a CiLV-C2 generic primer pairs (Olmedo-Velarde et al. 2021) were used in the RT-PCR assays. All five passion fruit samples from Meta failed to produce either CiLV-C2 or CiLV-C2H or PfGSV amplicon whereas all three Casanare samples successfully amplified 321, 244 and 299 nts of PfGSV-RNA1 and -RNA2 amplicons using C13F/C13R, C6F/C6R and C8F/C8R primers, respectively. Bi-directional amplicon sequencing followed by BlastN analysis revealed ≥99% nt identity with the PfGSV-RNA1 (MK804173) and -RNA2 (MK804174) genome sequences. An optimized ribo-depleted library preparation protocol was utilized to prepare two cDNA libraries using the RNA extracts of a PfGSV suspected positive (Casanare) and a negative (Meta) samples (Chellappan et al., 2022). HTS libraries of Casanare and Meta samples resulted in 22.7 to 29.5 million raw reads, respectively. After adapter trimming and filtering, clean reads were mapped to the Arabidopsis thaliana reference genome and unmapped reads were de novo assembled (Chellappan et al., 2022). BlastN analysis from the assembled contigs identified 1-3 contigs corresponding to PfGSV-RNA1 and -RNA2, respectively, from Casanare sample whereas 3 contigs of SMV were identified in Meta passion fruit sample. No other virus sequence was obtained from either of the libraries. Assembled contigs covered 99.33% of the RNA1 and 94.42% of the RNA2 genome, with read depths of 64,474 and 119,549, respectively. Meta sample contigs (OP564897) covered >99% of the SMV genome, which shared >99% nt identity with the Colombian SMV isolates (KY249378, MW655827). Both RNA-1 (OP564895) and -2 (OP564896) segments of the Casanare isolate shared 99% nt identity with PfGSV isolate (MK804173-74). Our discovery identified PfGSV in Colombia, for the first-time outside Brazil and Paraguay. The findings of PfGSV in yellow passion fruit increases the potential threat and possibility of PfGSV movement via Brevipalpus sp. from passion fruit to other hosts.

The tomato yellow leaf curl virus C4 protein alters the expression of plant developmental genes correlating to leaf upward cupping phenotype in tomato.

Tomato yellow leaf curl virus (TYLCV), a monopartite begomovirus in the family Geminiviridae, is efficiently transmitted by the whitefly, Bemisia tabaci, and causes serious economic losses to tomato crops around the world. TYLCV-infected tomato plants develop distinctive symptoms of yellowing and leaf upward cupping. In recent years, excellent progress has been made in the characterization of TYLCV C4 protein function as a pathogenicity determinant in experimental plants, including Nicotiana benthamiana and Arabidopsis thaliana. However, the molecular mechanism leading to disease symptom development in the natural host plant, tomato, has yet to be characterized. The aim of the current study was to generate transgenic tomato plants expressing the TYLCV C4 gene and evaluate differential gene expression through comparative transcriptome analysis between the transgenic C4 plants and the transgenic green fluorescent protein (Gfp) gene control plants. Transgenic tomato plants expressing TYLCV C4 developed phenotypes, including leaf upward cupping and yellowing, that are similar to the disease symptoms expressed on tomato plants infected with TYLCV. In a total of 241 differentially expressed genes identified in the transcriptome analysis, a series of plant development-related genes, including transcription factors, glutaredoxins, protein kinases, R-genes and microRNA target genes, were significantly altered. These results provide further evidence to support the important function of the C4 protein in begomovirus pathogenicity. These transgenic tomato plants could serve as basic genetic materials for further characterization of plant receptors that are interacting with the TYLCV C4.

First report of the hibiscus strain of citrus leprosis virus C2 infecting passionfruit (Passiflora edulis).

In Hawaii, passionfruit (Passiflora edulis; Passifloraceae) is grown primarily in residential properties and community gardens (CG). In 2019, passionfruit plants displaying chlorotic spots on young leaves, and green spots in senescing leaves were observed at two CG in Honolulu. Symptoms resembled those of passionfruit green spot virus (PfGSV) infection in Passiflora spp. (Ramos-González et al. 2020) and of the hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) infection in hibiscus in Hawaii (Melzer et al. 2013). Both viruses belong to the genus Cilevirus, family Kitaviridae. Total RNA was extracted from two sample pools comprised of 40 symptomatic leaves collected from both the CG following a CTAB-based procedure (Li et al. 2008). To identify the virus associated with the P. edulis infection, reverse transcription (RT)-polymerase chain reaction (PCR) was performed using CiLV-C2 (Olmedo-Velarde et al. 2021) and PfGSV specific primers (Ramos-González et al. 2020). RT-PCR assay amplified the CiLV-C2 amplicon but failed to produce the PfGSV amplicon from infected leaves. Amplicon sequencing followed by a BLASTn search showed the nucleotide sequence had >99% identity with the CiLV-C2H-RNA1 (KC626783). A ribo-depleted RNA library created using the TruSeq Stranded Total RNA Library Prep kit (Illumina) underwent high throughput sequencing (HTS) on a NextSeq550 Illumina platform (2x75 cycles). The 6.5 million raw reads obtained were trimmed, filtered, and de novo assembled using Metaviral SPAdes v. 3.15.02 (Antipov et al. 2020). The resulting contigs were searched against an in-house database generated from GenBank virus and viroid sequences using BLASTn. This identified 12 and 3 contigs corresponding to CiLV-C2H and watermelon mosaic virus, respectively, with the latter being previously reported in passionfruit (Watanabe et al. 2016). RNA1 contigs covered 80.17% of the CiLV-C2H genome, whereas RNA2 contigs covered 94.5% with an average coverage depth of 31.660 and 57.121, respectively. To obtain the near complete genome of CiLV-C2H, gaps from the assembled HTS data were filled by overlapping RT-PCR followed by Sanger sequencing. RNA1 (8,536 nt, Acc. No. MW413437) and RNA2 (4,878 nt, MW413438) genome sequences shared 99.2% and 97.0% identity with CiLV-C2H-RNA1 (KC626783) and -RNA2 (KC626784). To further confirm the presence of CiLV-C2H in symptomatic P. edulis plants, 40 symptomatic leaf samples were individually tested by RT-PCR, and 30 samples were positive. Brevipalpus mites collected from CiLV-C2H-positive P. edulis leaves were transferred to common bean (Phaseolus vulgaris) seedlings (Garita et al. 2013). At 15-30 days post-transfer, RNA extracted from lesions observed in recipient plants tested positive for CiLV-C2H by RT-PCR. Total RNA from individual Brevipalpus mites was isolated, and cDNA was prepared to tentatively identify the mite species involved in CiLV-C2H transmission in passionfruit (Druciarek et al 2019, Olmedo-Velarde et al. 2021). CiLV-C2H was detected in individual mites, and the 28S ribosomal mite RNA sequence (MZ478051) shared 99-100% nucleotide identity with B. yothersi (MK293678 and MT812697), a vector of CiLV-C2 (Roy et al. 2013). CiLV-C2 currently has a host range limited to the families Malvaceae, Araceae, and Rutaceae (Roy et al. 2015). CiLV-C2H infects hibiscus alone and citrus in mixed infection with CiLV-C2 (Roy et al; 2018) which is responsible for causing citrus leprosis disease. Detection of CiLV-C2H in passionfruit expands the number of host families of CiLV-C2H.

High-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex.

Citrus leprosis (CiL) is one of the destructive emerging viral diseases of citrus in the Americas. Leprosis syndrome is associated with two taxonomically distinct groups of Brevipalpus-transmitted viruses (BTVs), that consist of positive-sense Cilevirus, Higrevirus, and negative-sense Dichorhavirus. The localized CiL symptoms observed in multiple citrus species and other alternate hosts indicates that these viruses might have originated from the mites and eventually adopted citrus as a secondary host. Genetic diversity in the genomes of viruses associated with the CiL disease complex have complicated current detection and diagnostic measures that prompted the application of High-Throughput Sequencing (HTS) protocols for improved detection and diagnosis. Two cileviruses are known to infect citrus, and among them only citrus leprosis virus C2 (CiLV-C2) hibiscus strain (CiLV-C2H) has been reported in hibiscus and passion fruit in the US. Based on our current CiL disease complex hypothesis, there is a high probability that CiL disease is associated with more viruses/strains that have not yet been identified but exist in nature. To protect the citrus industry, a Ribo-Zero HTS protocol was utilized for detection of cileviruses infecting three different hosts: Citrus spp., Swinglea glutinosa, and Hibiscus rosa-sinensis. Real-time RT-PCR assays were used to identify plants infected with CiLV-C2 or CiLV-C2H or both in mixed infection in all the above-mentioned plant genera. These results were further confirmed by bioinformatic analysis using HTS generated data. In this study, we utilized HTS assay in confirmatory diagnostics to screen BTVs infecting Dieffenbachia sp. (family: Araceae), Passiflora edulis (Passifloraceae), and Smilax auriculata (Smilacaceae). Through the implementation of HTS and downstream data analysis, we detected not only the known cileviruses in the studied hosts but also discovered a new strain of CiLV-C2 in hibiscus from Colombia. Phylogenetically, the new hibiscus strain is more closely related to CiLV-C2 than the known hibiscus strain, CiLV-C2H. We propose this strain to be named as CiLV-C2 hibiscus strain 2 (CiLV-C2H2). The findings from the study are critical for citrus growers, industry, regulators, and researchers. The possible movement of CiLV-C2H2 from hibiscus to citrus by the Brevipalpus spp. warrants further investigation.

Smilax auriculata: A new host for Orchid fleck dichorhavirus identified in Florida, USA.

In June 2020, Orchid fleck virus (OFV) was detected in a species of Liriope in Leon and Alachua County, Florida (Fife et al; 2021). In October of the same year, four adjacent dune/ear-leaf greenbrier vines, Smilax auriculata (Smilaceae: Liliales), showed yellowing and mottling symptoms (Figure 1). Infected and healthy S. auriculata leaves samples were collected in Alachua County by the Florida Department of Agriculture and Consumer Services, Gainesville, Florida. OFV primers successfully detected in four Smilax samples by conventional RT-PCR assay. Amplicon sequences (Acc. No. MZ645935 and MZ645938) shared 99% nucleotide identity with OFV infecting orchids (LC222629) and citrus (MK522804). The OFV subgroup I (OFV-Orc1) and subgroup II (OFV-Orc2) specific primers (Kondo et al 2017) were utilized to confirm the presence of OFV type strains infecting Smilax. Sanger sequencing of subgroup I specific amplicons (MZ645934) shared 99% nucleotide identity with OFV-Orc1 (LC222629) whereas subgroup II specific amplicon sequence (MZ645930) shared 98-99 % nucleotide identity with OFV-Orc2 (AB244417). Further confirmation was done by USDA-APHIS-PPQ-Plant Pathogen Confirmatory Diagnostics Laboratory utilizing optimized conventional RT-PCR protocols (Roy et al. 2020) and deep sequencing on a on a NextSeq550 Illumina platform. Assembled reads identified seven non-overlapping viral contigs. Five RNA1 and two RNA2 contigs covered more than 97% of the bipartite OFV genome with average coverage depth of 5297.61 and 5186.04, respectively. Contigs of RNA1 and RNA2 shared 98-99% nt identity to OFV-Orc2-RNA1 (AB244417) and OFV-Orc-RNA2 (AB244418 and LC222630). No other pathogen sequences were identified. This is the first time the genus Smilax has been identified as a natural host of OFV. Very recent findings of OFV-Orc in Florida in Liriope, Aspidistra, and Ophiopogon among the Asparagaceae family members (Fife et al; 2021) and now in the Smilacaceae suggest a broader host range of the virus than previously known; further research should be conducted to better characterize the potential risk of introduction into citrus in Florida.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Comprehensive transcriptome analysis and functional characterization of PR-5 for its involvement in tomato Sw-7 resistance to tomato spotted wilt tospovirus.

Tomato spotted wilt tospovirus (TSWV), one of the most important plant viruses, causes yield losses to many crops including tomato. The current disease management for TSWV is based mainly on breeding tomato cultivars containing the Sw-5 locus. Unfortunately, several Sw-5 resistance-breaking strains of TSWV have been identified. Sw-7 is an alternative locus conferring resistance to a broad range of TSWV strains. In an effort to uncover gene networks that are associated with the Sw-7 resistance, we performed a comparative transcriptome profiling and gene expression analysis between a nearly-isogenic Sw-7 line and its susceptible recurrent parent (Fla. 8059) upon infection by TSWV. A total of 1,244 differentially expressed genes were identified throughout a disease progression process involving networks of host resistance genes, RNA silencing/antiviral defense genes, and crucial transcriptional and translational regulators. Notable induced genes in Sw-7 include those involved in callose accumulation, lignin deposition, proteolysis process, transcriptional activation/repression, and phosphorylation. Finally, we investigated potential involvement of PR-5 in the Sw-7 resistance. Interestingly, PR-5 overexpressed plants conferred enhanced resistance, resulting in delay in virus accumulation and symptom expression. These findings will facilitate breeding and genetic engineering efforts to incorporate this new source of resistance in tomato for protection against TSWV.

Using Small RNA-seq Data to Detect siRNA Duplexes Induced by Plant Viruses.

Small interfering RNA (siRNA) duplexes are short (usually 21 to 24 bp) double-stranded RNAs (dsRNAs) with several overhanging nucleotides at both 5'- and 3'-ends. It has been found that siRNA duplexes bind the RNA-induced silencing complex (RISC) and cleave the sense strands with endonucleases. In this study, for the first time, we detected siRNA duplexes induced by plant viruses on a large scale using next-generation sequencing (NGS) data. In addition, we used the detected 21 nucleotide (nt) siRNA duplexes with 2 nt overhangs to construct a dataset for future data mining. The analytical results of the features in the detected siRNA duplexes were consistent with those from previous studies. The investigation of siRNA duplexes is useful for a better understanding of the RNA interference (RNAi) mechanism. It can also help to improve the virus detection based on the small RNA sequencing (sRNA-seq) technologies and to rationally design siRNAs for RNAi experiments.

VirusDetect: An automated pipeline for efficient virus discovery using deep sequencing of small RNAs.

Accurate detection of viruses in plants and animals is critical for agriculture production and human health. Deep sequencing and assembly of virus-derived small interfering RNAs has proven to be a highly efficient approach for virus discovery. Here we present VirusDetect, a bioinformatics pipeline that can efficiently analyze large-scale small RNA (sRNA) datasets for both known and novel virus identification. VirusDetect performs both reference-guided assemblies through aligning sRNA sequences to a curated virus reference database and de novo assemblies of sRNA sequences with automated parameter optimization and the option of host sRNA subtraction. The assembled contigs are compared to a curated and classified reference virus database for known and novel virus identification, and evaluated for their sRNA size profiles to identify novel viruses. Extensive evaluations using plant and insect sRNA datasets suggest that VirusDetect is highly sensitive and efficient in identifying known and novel viruses. VirusDetect is freely available at http://bioinfo.bti.cornell.edu/tool/VirusDetect/.

A single base pair in the right terminal domain of tomato planta macho viroid is a virulence determinant factor on tomato.

Tomato planta macho viroid (TPMVd), including isolates previously designated as Mexican papita viroid (MPVd), causes serious disease on tomatoes in North America. Two predominant variants, sharing 93.8% sequence identity, incited distinct severe (MPVd-S) or mild (MPVd-M) symptoms on tomato. To identify virulence determinant factor, a series of chimeric infectious clones were generated using synthetic DNA approach to progressively replace each structural domain between the two variants. In bioassays on tomato 'Rutgers', three chimeras containing Terminal Left and Pathogenicity (MPVd-H1), Central (MPVd-H2), or Variable (MPVd-H3) of MPVd-S, incited mild to intermediate symptoms. However, a chimera containing Terminal Right (TR) of MPVd-S (MPVd-H4) incited severe symptoms. Only one base-pair mutation in the TR domain between MPVd-M (176U:A185) and MPVd-S (174G:C183) was identified. A reciprocal mutant (MPVd-H5) rendered the chimeric viroid mild on tomato. This single base-pair in the TR domain was determined as the virulence determinant factor for TPMVd.

Molecular and Biological Characterization of Tomato mottle mosaic virus and Development of RT-PCR Detection.

Tomato mottle mosaic virus (ToMMV) was first identified in 2013 as a novel tobamovirus infecting tomatoes in Mexico. In just a few years, ToMMV has been identified in several countries around the world, including the United States. In the present study, we characterized the molecular, serological, and biological properties of ToMMV and developed a species-specific RT-PCR to detect three tomato-infecting tobamoviruses: Tobacco mosaic virus (TMV), Tomato mosaic virus (ToMV), and ToMMV. Previously, ToMMV has been reported in Florida and New York. In this study, we made two new reports on the occurrences of ToMMV on tomatoes in California and South Carolina. Their complete genome sequences were obtained and their genetic relationships to other tobamoviruses evaluated. In host range studies, some differential responses in host plants were also identified between ToMMV and ToMV. To alleviate cross-serological reactivity among the tomato-infecting tobamoviruses, a new multiplex RT-PCR was developed to allow for species-specific detection and identification of TMV, ToMV, and ToMMV. In addition, we observed resistance breaking by ToMMV on selected tomato cultivars that were resistant to ToMV. This has caused serious concerns to tomato growers worldwide. In conclusion, the characterization in molecular and biological properties of ToMMV would provide us with fundamental knowledge to manage this emerging virus on tomato and other solanaceous crops in the U.S. and around the world.

Complete Genome Sequence of a Tomato-Infecting Tomato Mottle Mosaic Virus in New York.

The complete genome sequence of an isolate of tomato mottle mosaic virus (ToMMV) infecting tomatoes in New York was obtained using small RNA (sRNA) deep sequencing. ToMMV_NY-13 shared 99% sequence identity with isolates from Mexico and Florida. Broader distribution of this emerging virus is a cause for concern to the tomato industry.

Complete Genome Sequence of Southern tomato virus Identified in China Using Next-Generation Sequencing.

The complete genome sequence of Southern tomato virus (STV), a double-stranded RNA virus that affects tomato in China, was determined using small RNA deep sequencing. This Chinese isolate shares 99% sequence identity to other isolates from Mexico, France, Spain, and the United States. This is the first report of STV infecting tomatoes in Asia.

Complete Genome Sequence of Southern tomato virus Naturally Infecting Tomatoes in Bangladesh.

The complete genome sequence of a Southern tomato virus (STV) isolate on tomato plants in a seed production field in Bangladesh was obtained for the first time using next-generation sequencing. The identified isolate, STV_BD-13, shares a high degree of sequence identity (99%) with several known STV isolates worldwide.

Complete genome sequence of an emerging genotype of tobacco streak virus in the United States.

We report here the complete genome sequence of an emerging genotype of tobacco streak virus (TSV) infecting zucchini squash in Florida (TSV_FL13-07), obtained using deep sequencing of short RNAs (sRNAs) and validation by Sanger sequencing. TSV_FL13-07 shares only <90% sequence identity in all three genomic RNAs to several known U.S. isolates.

Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.

Despite a general repression of translation under hypoxia, cells selectively upregulate a set of hypoxia-inducible genes. Results from deep sequencing revealed that Let-7 and miR-103/107 are hypoxia-responsive microRNAs (HRMs) that are strongly induced in vascular endothelial cells. In silico bioinformatics and in vitro validation showed that these HRMs are induced by HIF1α and target argonaute 1 (AGO1), which anchors the microRNA-induced silencing complex (miRISC). HRM targeting of AGO1 resulted in the translational desuppression of VEGF mRNA. Inhibition of HRM or overexpression of AGO1 without the 3' untranslated region decreased hypoxia-induced angiogenesis. Conversely, AGO1 knockdown increased angiogenesis under normoxia in vivo. In addition, data from tumor xenografts and human cancer specimens indicate that AGO1-mediated translational desuppression of VEGF may be associated with tumor angiogenesis and poor prognosis. These findings provide evidence for an angiogenic pathway involving HRMs that target AGO1 and suggest that this pathway may be a suitable target for anti- or proangiogenesis strategies.

Small RNA profiling reveals phosphorus deficiency as a contributing factor in symptom expression for citrus huanglongbing disease.

Huanglongbing (HLB) is a devastating citrus disease that is associated with bacteria of the genus 'Candidatus Liberibacter' (Ca. L.). Powerful diagnostic tools and management strategies are desired to control HLB. Host small RNAs (sRNA) play a vital role in regulating host responses to pathogen infection and are used as early diagnostic markers for many human diseases, including cancers. To determine whether citrus sRNAs regulate host responses to HLB, sRNAs were profiled from Citrus sinensis 10 and 14 weeks post grafting with Ca. L. asiaticus (Las)-positive or healthy tissue. Ten new microRNAs (miRNAs), 76 conserved miRNAs, and many small interfering RNAs (siRNAs) were discovered. Several miRNAs and siRNAs were highly induced by Las infection, and can be potentially developed into early diagnosis markers of HLB. miR399, which is induced by phosphorus starvation in other plant species, was induced specifically by infection of Las but not Spiroplasma citri that causes citrus stubborn-a disease with symptoms similar to HLB. We found a 35% reduction of phosphorus in Las-positive citrus trees compared to healthy trees. Applying phosphorus oxyanion solutions to HLB-positive sweet orange trees reduced HLB symptom severity and significantly improved fruit production during a 3-year field trial in south-west Florida. Our molecular, physiological, and field data suggest that phosphorus deficiency is linked to HLB disease symptomology.

Host small RNAs are big contributors to plant innate immunity.

Small RNAs regulate gene expression in many cellular processes. Emerging evidence suggests that host endogenous small RNAs and host RNA-silencing machinery represent a fundamental layer of control in plant immune responses. Pathogen-responsive endogenous small RNAs regulate gene expression reprogramming and fine-tuning in plant immune responses. Here we discuss the function of endogenous small RNAs, including microRNAs (miRNAs), small interfering RNAs (siRNAs), and long siRNAs (lsiRNAs), in plant immune responses and the strategies that pathogens have acquired to suppress host small-RNA pathways. Host endogenous small RNAs and small-RNA pathways play an important role in the plant immune responses to pathogen challenges.

Identification of miniature inverted-repeat transposable elements (MITEs) and biogenesis of their siRNAs in the Solanaceae: new functional implications for MITEs.

Small RNAs regulate the genome by guiding transcriptional and post-transcriptional silencing machinery to specific target sequences, including genes and transposable elements (TEs). Although miniature inverted-repeat transposable elements (MITEs) are closely associated with euchromatic genes, the broader functional impact of these short TE insertions in genes is largely unknown. We identified 22 families of MITEs in the Solanaceae (MiS1-MiS22) and found abundant MiS insertions in Solanaceae genomic DNA and expressed sequence tags (EST). Several Solanaceae MITEs generate genome changes that potentially affect gene function and regulation, most notably, a MiS insertion that provides a functionally indispensable alternative exon in the tobacco mosaic virus N resistance gene. We show that MITEs generate small RNAs that are primarily 24 nt in length, as detected by Northern blot hybridization and by sequencing small RNAs of Solanum demissum, Nicotiana glutinosa, and Nicotiana benthamiana. Additionally, we show that stable RNAi lines silencing DICER-LIKE3 (DCL3) in tobacco and RNA-dependent RNA polymerase 2 (RDR2) in potato cause a reduction in 24-nt MITE siRNAs, suggesting that, as in Arabidopsis, TE-derived siRNA biogenesis is DCL3 and RDR2 dependent. We provide evidence that DICER-LIKE4 (DCL4) may also play a role in MITE siRNA generation in the Solanaceae.